Show me how to post my homework

Just do my homework!

  • HTML tags will be transformed to conform to HTML standards.
  • Add rel="nofollow" to external links
Submitted by carine on Wed, 2012-07-04 17:59
due date not specified
not answered

a scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene...

a scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene was determined as written below: 3'gacacgtacgagcctggacaccttaagagcgggctcggaacactggccccgattgacac5' (a) study the nucleotide sequence of the template strand and write sense strand (showing direction) of the gene. (b) write down the mrna produces from this gene. (c) how many amino acids will be present in the protein product of this gene. (d) write amino acid sequence of the polypeptide